Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

EST details — SGN-E306475

Search information 
Request: 306475Match: SGN-E306475
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C93144Clone name: cLEX-13-M9
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306475Length: 591 bp (1072 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306475 [] (trimmed) GGGTATAACTCCAGTATATCAAGTAATGCAATCAATATTGAAAGATCCTGAAGACGATACAGAGATGTATGTGGTGTATGCAAACAGAACGGAGG
ATGATATTTTGCTCAAAGACGAACTTGATGCATGGGCAGAGCAAGTTCCAAATAGGGTTAAAGTATGGTATGTCGTTCAAGAATCCATTACACAA
GGATGGAAGTATAGTACAGGATTCGTTACAGAATCGATTCTTAGAGAACATATACCTGAACCATCTCATACAACATTGGCATTAGCATGTGGACC
ACCTCCAATGATACAATTTGCTATTAATCCAAACTTGGAGAAAATGGGATATGACATTAAGGAGGAACTATTGGTGTTCTAAATTGGATGGTGAT
GATGATAGATGATATATCTCTTTGGAGGAATAAATTCTTTTGTATTTTCAGTTGTACATATTGTGTTTTTGTTTATCATCAAAATGTACTACTTC
TTGTAGTTCTTACATTTTAATTTTCTACTCAACTTTAGGTATAAAATGTTGTACTGTGTACTAGTATGTGTATGTCAAAGTTAAGATTGTATTCA
TCATGGAATTACAAGTACTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306475] SGN-U579543 Tomato 200607 Build 2 103 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T117568 [Download] [View] Facility Assigned ID: TRXBW77TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0088 Quality Trim Threshold: 12.5