EST details — SGN-E306814

Search information 
Request: 306814Match: SGN-E306814
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C95339Clone name: cLEY-11-I10
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C192731 [TUS-66-G1] Trace: SGN-T345053 EST: SGN-E544178 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E306814Length: 600 bp (851 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E306814 [] (trimmed) GGGCTGATGGATCGAGGTCAAGGGAAGAAGCTTTTGATGGTCACATGGCAATTGGCAGGGTTTTGTATGATCAACATTTGTTTAAGGAAGCACTG
GTGAGCTTTAAGAGAGCTTGTGAGTTGCAGCCTGCTGATGTTAGGCCACATTTCAGGGCTGGCAATTGTTTGTATGTGCTCGGGAGACATAGTGA
GTCGAAAGAGGAGTTCTTGCTGGCATTGGAGGCTGCTGAAGCTGGTGGCAGTCAGTGGGCTTATTTGCTTCCTCAGATTCATGTGAATTTGGGAA
TTGCTCTTGAAGGCGAAGGTATGGTTATAAGTGCCTGTGAACATTATAGAGAGGCTGCTATTTTGTGTCCAACTCATTTTAGAGCTTTGAAACTT
TTGGGTAGTGCACTTTTTGGCGTGGGTGAGTATAAGGCAGCTGTTAAGGCATTATAAGAGGCCATTTATATGAAGAGTGACTATGCTGATGCACA
TTGTGATCTTGCTTCTGCATTGCACGCAATGGGTGATGATGATAATGCTATTAAGGAGTTTCAGAGAGCTATTGATTTGAAACCTGGTCATGTTG
ATGCCTTGTACAATTTAAGTGGACTTTACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E306814] SGN-U568667 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T118738 [Download] [View] Facility Assigned ID: TRYBP53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0059 Quality Trim Threshold: 14.5