EST details — SGN-E30740

Search information 
Request: 30740Match: SGN-E30740
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C20131Clone name: cLED-29-G16
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C20131 [cLED-29-G16] Trace: SGN-T56093 EST: SGN-E239805 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E30740Length: 408 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E30740 [] (called/trimmed by facility)
GAATTTGTGAATAATTTAATCATTTTCGATTTTCATTGAAATTTGTGTGCAATGGCTACGATGGGAATGACGGGAAGTATTGGGGGTTATGGAGC
AGCTTCAGCGTCTCTGTTTCGATTGAGGAACTCAGCGAAGAAGAAGACTAGAAACGGTAAAAATGGATTTAGGGTTTCATGTGTTTGTTCATCTT
CTGCTGTTGCCGATCCGTATAAGACCTTGAAGATTCAACCCGGTGCATCTGAATCTGAAGTTAGGAAGGCGTTTAGACAGCTTGCTCTTAAGTAT
CACCCAGACGTATGCAGAGGAAACAATTGTGGGGTTCAATTTCACCAAATCAACGAAGCTTACGATGTGGTGATGAGTAATTTGAGAGGTGAAAC
AAGAGCAGAGCTGGAGATGATTGAGGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T56093 [Download] [View] Facility Assigned ID: TOVEJ44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence