EST details — SGN-E307514
| Search information |
| Request: 307514 | Match: SGN-E307514 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C97928 | Clone name: cLEY-24-G23 |
| ||
| Library Name: cLEY | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: root
Development Stage: pre-anthesis/pre-fruit loading
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E307514 | Length: 152 bp (876 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E307514 [] (trimmed)
GCCTCCTGCCGAATTCAGCACGAGGGTGGCTTGGTTTTTCTGTATAATTGCTGATCACCATGTAAGGCCACTCTAGTGTTTCCTTTGTTTTGATT
TGATTTATGTATTAACAACTGAATGATCCTCAGTTAGGAAAACAAAATTCTTTTTGG
TGATTTATGTATTAACAACTGAATGATCCTCAGTTAGGAAAACAAAATTCTTTTTGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E307514] | SGN-U591160 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T121322 [Download] [View] | Facility Assigned ID: TRYDO48TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.911 | Expected Error Rate: 0.0122 | Quality Trim Threshold: 12.5 |
Working
