EST details — SGN-E309231
| Search information |
| Request: 309231 | Match: SGN-E309231 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C97533 | Clone name: cLEY-22-A5 |
| ||
| Library Name: cLEY | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: root
Development Stage: pre-anthesis/pre-fruit loading
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E309231 | Length: 157 bp (952 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E309231 [] (trimmed)
AAATCCTGGTTTCCTTTGGGGTCTTGGATTTTTTACTATTGATGTTCTAAGAGGTACCGATAGAAGCATGAAAATTGAATATCAGGCTTACGTTA
CAGTTAAACCTGAGTTTTATTATATCGTGTATGTTTAATGTAATTCTAGTTTTGCTCTTATC
CAGTTAAACCTGAGTTTTATTATATCGTGTATGTTTAATGTAATTCTAGTTTTGCTCTTATC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E309231] | SGN-U577270 | Tomato 200607 | Build 2 | 20 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T120936 [Download] [View] | Facility Assigned ID: TRYDG03TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.869 | Expected Error Rate: 0.0085 | Quality Trim Threshold: 12.5 |
Working
