EST details — SGN-E309339

Search information 
Request: 309339Match: SGN-E309339
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C97527Clone name: cLEY-22-A19
cartOrder Clone
Library Name: cLEYOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: pre-anthesis/pre-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193144 [TUS-67-H6] Trace: SGN-T345762 EST: SGN-E544887 Direction: 5' Facility: INRA (MWG)
Clone: SGN-C193144 [TUS-67-H6] Trace: SGN-T349991 EST: SGN-E549116 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E309339Length: 297 bp (997 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E309339 [] (trimmed) GAATGTGTGGGAAATTAATAGAGATTCTACTTTTTGGGAGGATCCCTTAATGTTTAAGCCTGAGAGGTTTTGGCATTCAAATTTATACGTGCGAG
GACAAGATTTTGAACTGATCCCATTTGGTGCGGGTAGAAGAATGTGCCCTGCCTTGCCACTTGCATTGCGAATGATTCCAGTCATGTTGGGCTCA
CTCTTGAATTCCTTCAATTGGAAACTCGAGGCAGGCATTAGACCAGAAGACCTAGACATGGAGGAAAAATTTGGTTTGGCTTTAATCAAAGCTCA
TCCTTTGCGGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E309339] SGN-U571339 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T121044 [Download] [View] Facility Assigned ID: TRYDG10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.951 Expected Error Rate: 0.0195 Quality Trim Threshold: 12.5