EST details — SGN-E310544

Search information 
Request: 310544Match: SGN-E310544
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99758Clone name: cLEZ-19-C22
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310544Length: 430 bp (869 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E310544 [] (trimmed) GGCTTAGGAAGTCTAGGCGATCAAGAAACTTCAGCGAGGGGAGTAGCAGTTTTAAGGGCTTATCTGCAGTAAGCTCTTTTGGAAGAATGGTTGGT
CGTGGCTCTGGTAGAATTGCTGCTGAAAACGAATACATTGATAAGCCAATAATCCTTGACTAATTGCAGAATTTTGCATCAAGACTTCCAATTAG
CATGATTTTTTAAGAGCATCCTAAATGGTATATATCGATAAATCTCTCTCCAATCTCTTGTTACCACATTTTTTTACAGTTGAAATAGAAGGAAT
TCTTTGACAGTTGCCTCATTTTTTGTTCTGTTTTGTCCTGGCTGATGAAAATTCAACATTCTCTCGATGTGTAATGTTATAGGAACAGNCCATAA
TATAAATATGAAAGTCTAATAATTTGTGAATGAAAATGACATTTCTTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310544] SGN-U591395 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123745 [Download] [View] Facility Assigned ID: TRZCV23TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0064 Quality Trim Threshold: 12.5