EST details — SGN-E310929

Search information 
Request: 310929Match: SGN-E310929
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99476Clone name: cLEZ-17-L3
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193537 [TUS-68-H15] Trace: SGN-T346436 EST: SGN-E545561 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193537 [TUS-68-H15] Trace: SGN-T346437 EST: SGN-E545562 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E310929Length: 602 bp (885 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E310929 [] (trimmed) GTGGAAACTTACTCCTCTGTTCCAATGGAGAAAACAACCAAAATTATAAGAAAATCAATCTTCATTTTCCTTCAGAACTATCAGTTCTTCACAAC
AACAACAGCTTGTTTCGCTTTTCCATTTGCTGCTTCTGTTCTTTTTCTACAATCATTCATCTATTCGGCATCGCTTTATCCAATAATTTATGAGC
GTTTGCATTTACTTTTCGACGCAGCAGGGTGCCCTTCATCGGCAGAATTCTTCATTCTTCTCAATTCCAAGATCTCGTCAGACGATTGTGATATC
TTTTCTTTCATTCCCTTTTACCATTTGCTTTTATCTTTTCGCCAAATCTGTGGTAATCGAATCTCTGAAATACTCAAAACCATCTCAAAGAACTA
CATTTCCTTCGTATTTCAACCTTCTTGTCACCCAGCTCTGTAACTCACTACTCATCATTTCCGCAAACGCCACCTGGTTCACTCTGCTATTCTTC
GGGTTCAATCTCTTTGATTATGGATTCGGGCTTTCGAATCCAAGAACAATTCTTTTGGTATCAGCAACAGGGGCTGTACTCTGTTCTATTATACT
CGCAAACACTATAATTATTTGTAATTTGGCAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E310929] SGN-U576065 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123354 [Download] [View] Facility Assigned ID: TRZCO62TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.937 Expected Error Rate: 0.0156 Quality Trim Threshold: 14.5