EST details — SGN-E311358

Search information 
Request: 311358Match: SGN-E311358
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99669Clone name: cLEZ-18-M12
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193580 [TUS-68-J10] Trace: SGN-T346510 EST: SGN-E545635 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193580 [TUS-68-J10] Trace: SGN-T346511 EST: SGN-E545636 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311358Length: 485 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311358 [] (trimmed) GCTCTCTCTAAAATGCCAACTCCATATTGATCAGTTCATTAATCTCCGGTACGCTTTGTGGTTTCCCGTCTAACTCCATTGTAGTCGGAAACAAT
GGCGGTTCCCAGCGAGAATCACAGTTCCGGGAATTCACTCTCTAGTTTTTTCACTTCACGAACTCCTATTTTAGGTCTTCAGCTCTACATCGTGA
TTGCCGCTACTGTTATCATTATGGTTGTCGTGCTTTTTCTCATCTTTCTACTTCTCAGGCTAAATCAAAGCTCGAAAAGACGTCGCAGTGGAGGT
AAGAAGAATGCCGGGTTGTTACCTTTGGTAGCTGATGTGATTCGCGACAGTAGAACAACCGATCTCAATGAGATTGGTAAAGTGAATCATTTATT
GAAAAAGGAGAATGAGACTATTGCGATTCTCCGTAAAGAAGATCAGGAAGTGATCGAGATTGAGTCCGATGGTTTAAAAGGAAGTTCAGGGAGTA
ATGAGTCAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311358] SGN-U579943 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123573 [Download] [View] Facility Assigned ID: TRZCR78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0254 Quality Trim Threshold: 14.5