EST details — SGN-E311501

Search information 
Request: 311501Match: SGN-E311501
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C99723Clone name: cLEZ-18-P16
cartOrder Clone
Library Name: cLEZOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: germinating seedlings

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193586 [TUS-68-J16] Trace: SGN-T346521 EST: SGN-E545646 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193586 [TUS-68-J16] Trace: SGN-T350116 EST: SGN-E549241 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E311501Length: 549 bp (903 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E311501 [] (trimmed) GGCAACCACCTAACATTTGCTTCGTACAAAAAAAATTATGGCTGAAACTCAAGAAACAGTTTCCAAATCAGTACAAGAACTAGCAAATACCAATC
AAGTTCCAGAAAAGTATATTTATGCACAAGGATCAATCAATACCTATCCTCTTTTGTTCGATGTGCCACAAGTTGATCTTAGCCTTCTCACATCC
CCTAACAGACAACAACAGCTCAACAAACTTCAATCAGGTCTCAAGTCTTGTGGCTGTATCCAGGTCATAAATCATGGAATGGAAGATTCATTTCT
TGACAAAGTGCGTGAAATAAGCAAAAAGTTCTTTGCTCTTCCAACTGAAGAGAAGCTTAAATATGCAAGAACAGTTAATCAAATTGAAGGATACG
GAAATGATAAAGTTCTTACAGATAAGCAAAGGCTTGATTGGTCCGATAGACTGTGTCTAAATGTGTTCCCTGAAGATATAAGAGAACTCCGATTC
TGGCCACAAAAACCTGAATGTTTTAGGGAAGTTTTTGAAGAATATATGAAGAATATGAAGTTGTTGAGTGAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E311501] SGN-U563057 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T123716 [Download] [View] Facility Assigned ID: TRZCT92TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5