EST details — SGN-E312768

Search information 
Request: 312768Match: SGN-E312768
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C117591Clone name: cTOA-8-N11
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E312768Length: 574 bp (936 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E312768 [] (trimmed) AAACTGGCAAAGAGAGCTTTTTGAAATTTTCTTTCTCATTCTCTTGCTAGATAGCGGGTCAGGGGGCTATTGATTTCGTTCGTTGTTTTTAGGTA
TTTACTCTTTCAGTTATGCATTGTTTTTTGTGTGCAAATCGGTGATTCTGTATTTTTTTTATATGTTCATGTGCATTGATCATTTCCTTTCAAAC
AGCGATTTCATAAGCATTTGATATCTGAGAAGTATAAATTCTGTCATTTTTGTTCGAAAAGTTGTTCAGATTTCAGGTGTGAACTGTTTTGAGTA
GATGCGGAGAATCAAAGATAAATTATCAACAAGGTTAATGAATGTTTGTGTGGCATCTCTTTGTAAAGCCAAACAATTAGAGAAAGCTGAAATTG
TTATAGTTGATGGCATACGAATTGGATTGCAACCAGATGTTGTCACTTACAATACATTGATTGCTGCATATTGCCGCTTTGTTGGCATAGATGCT
GGTTATTCCATCCTTAATAGGATGAAGGATGCTGGAATTAACCCTGATGTTATTACCTATAACGCTTTGATCGCCGGAGCTACTAGAAATTCTCT
GTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E312768] SGN-U584418 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T124957 [Download] [View] Facility Assigned ID: TFABE78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0052 Quality Trim Threshold: 20.5