| SGN ID: SGN-C112195 | Clone name: cTOA-14-H2 |  | Order Clone |
|
| Library Name: cTOA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E313100 | Length: 312 bp (894 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E313100 [] (trimmed)
TCATCATTTCATAGAGCACTCTAGACCCCCAGAGTGACCTTCATCTATATAAACTCACAAGCTGCAATGCATCTCTCAGCAAATCTTGAAAACCC
CACATTTTAAATCTGCATTTTGCTTGAAGTTAACTATATTTTGAGGTTTTTTTCAAGAAATTGTGAATACCTTTTACATTCTTTAGTACTAAGAA
GGAAGCCATGGATGAGGATTTTGAGTTTCCTGTATCTTCTAACAATGCTGCTGCTGAAGAAATGGATATGGATATGGGGATGGGGATGGATGATA
TTGATGTCACTGGACCCGACCCGGTTA
[BLAST] [AA Translate]
| SGN-ID: SGN-T125943 [Download] [View] |
Facility Assigned ID: TFACD37TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
| Sequence Entropy: 0.956 |
Expected Error Rate: 0.0151 |
Quality Trim Threshold: 20.5 |
