Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E31526

Search information 
Request: 31526Match: SGN-E31526
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C1089Clone name: cLEC-10-M21
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184049 is on microarray TOM1: SGN-S1-1-2.1.19.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C1089 [cLEC-10-M21] Trace: SGN-T24799 EST: SGN-E201212 Direction: 5' Facility: TIGR
Clone: SGN-C184049 [TUS-43-M7] Trace: SGN-T196635 EST: SGN-E395309 Direction: 3' Facility: INRA
Clone: SGN-C184049 [TUS-43-M7] Trace: SGN-T196636 EST: SGN-E395310 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E31526Length: 420 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E31526 [] (called/trimmed by facility)
ATATGGCATTGTCTACCGGGGGAATTTGATTAATGGAACACCTGTAGCTATTAAGAAGCTCCTCAACAATCTAGGCCAAGCTGAGAAAGAGTTCC
AAGTGGAGGTTGAAGCCATTGGCCACGTGCGTCACAAAAATTTGGTCCGCCTTCTAGGATACTGCATTGAAGGAACTCACAGGATGCTGGTTTAC
GAGTATGTCAACAATGGCAATTTGGAACAGTGGCTTCATGGAGCTATGCGACACCACGGGTATCTCACTTGGGAGGCTAGGATGAAGGTTCTCCT
TGGGACAGCTAAAGCTCTTGCGTATTTGCATGAGAATATTGAGCCCAAAGTTGTTCATCGAGACATAAAATCAAGTAATATATTGATTGATGATG
ACTTCAATGCGAAGGTCTCTGATTTTGGTCTGGCCAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T24799 [Download] [View] Facility Assigned ID: TCABK83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence