EST details — SGN-E315464

Search information 
Request: 315464Match: SGN-E315464
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C114092Clone name: cTOA-22-L15
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E315464Length: 410 bp (948 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E315464 [] (trimmed) GGGATCATGCTTACATGAGCAAACAAATTGCAAAATACTGTTATCTTTTGATTGGAGTTTCATCAGCTGCACTCATTTTCAACACTCTACAGCAT
TACTACTGGGATGTAGTGGGGGAGAATTTGACAAAACGGGTGAGAGAGAAAATGCTGGCAGCTGTGCTTAAAATGGAAATGGCGTGGTTCGATCA
GGAAGAGAACGATAGTTCAAGAATTGCTGCTAGGCTCTCTCTGGATGCCAACAATGTTAGGTCAGCCATCGGGGATAGAATCTCCGTCATTATGC
AGAACTCAGCTCTCATGCTAGTCGCGTGCACAGCAGGATTCGTATTGCAGTGGCGTCTGGCCCTTGTCCTCATTGGGGTCTTCCCCGTGGTCGTT
GCAGCAACAGTTTTACAGAAAATGTTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E315464] SGN-U570304 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T127491 [Download] [View] Facility Assigned ID: TFADI68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5