EST details — SGN-E317324

Search information 
Request: 317324Match: SGN-E317324
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C116060Clone name: cTOA-28-P24
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E317324Length: 729 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E317324 [] (trimmed) TTCATCCGGCACGAGGTCCTGCTTCTGTCTCTTTGAACTGCTTTTTACTCATATTTTAGTCTTTCTTGATGATGGATGATGATTTACCTTGGATC
TTCACATTTTATTCAATATTGAAAAGTTCTGGTTTTGGGTGTTTTATTACATGATTTGTAATTTGTGGTCTGAGATTTCCTTGTTATCTTGAAAA
GGGTTTTTTTTTTCTCCTTTGTCTATTTACATTTGGTATCAGGAAAATGAAATTATTACAGTTTTTTAGCAGAAGTTTTTCTGGTTCTTGGATCC
ATGTTCATAAAGATTTGTTTTTTCAAAGGAATAAAACTGAACTTTTAAAGGAAGATGAGGACTTTCTAATCAATGGGGTTTCCATTTCTTGTTTG
AGATGTGTAACATAGCTCCAATTTTCATTTCTTGATGCTTTTCTTGGAGGACTGTGTTCCATTTATAATTGTCTTACTGCTGTGGGTTGTTTAAC
TTTTCCTCATAATTGACTTATAGATTCTTGTTTCTATGCAGGTCCAGTTCAGTCAGCTGTTCCAGAAGTTGTTGCTAGTAGAAATCTCTAAGTTT
CAGCCTAGATTCCAATCCAGTATGGGACTCTCACAGTATCCAACTCCAGCAGATGCAGGAGTGCTCTGTGTTATTCTAGTGAACACAGCCATATC
CATCTCCATTTGTCAGGAGATGGTCCGATCGATCCTTCATGTGATTGGCATCCACATTGCATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E317324] SGN-U589311 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T129428 [Download] [View] Facility Assigned ID: TFAEH96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.914 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5