| SGN ID: SGN-C122981 | Clone name: cTOB-8-H3 |  | Order Clone |
|
| Library Name: cTOB | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E317639 | Length: 388 bp (955 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E317639 [] (trimmed)
GCGCAGCTGCAGTAGTGTGGGCAATGACAGCCTTGATATCTAAACCAAATGCCATGAAGAAAGTTCAAGCTGAAATTCGAGAAATGGTTGGTAAA
AAGTCCATAGTGAATGAAGATGATATCCGAAATCTTCCATATTTTAAAGCAGTGATAAAAGAAACATTTAGATTGTATCCACCAGGTCCATTGCT
AATAGCAAGAGAGACGATGCAAAATTCCATACTAGAAGGATATGAAATTAAAGCAAAAACTATAGTTCATGTTAATATTTGGGCAATTGCAAGGG
ATCCTGAAATATGGGAAAATCCAGATGAATTTATACCTGAGAGGTTTTTGAATAGGGATATTGATCTTAAGGGCCAAAATTTTGAACTGATTCCA
TTTGGAGC
[BLAST] [AA Translate]
| SGN-ID: SGN-T130842 [Download] [View] |
Facility Assigned ID: TFBBE38TH
|
| Submitter: Koni |
Sequencing Facility: TIGR |
Funding Organization: National Science Foundation
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
| Sequence Entropy: 0.942 |
Expected Error Rate: 0.0194 |
Quality Trim Threshold: 12.5 |
