EST details — SGN-E318137

Search information 
Request: 318137Match: SGN-E318137
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C116362Clone name: cTOA-29-N18
cartOrder Clone
Library Name: cTOAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 0-3mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E318137Length: 608 bp (929 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E318137 [] (trimmed) GCATTTCCCTAAAAACACCGTCAAGAACCTCTCTTCTCCTCTTCTCGCCGCAACTTTCAATCGTTTCTATTGACGTAGTTCAACAGATCGAAAGA
TGTTTGGAAGAGCACCGAAGAAGAGCGATAATACAAAGTATTATGAGATCTTAGGAGTTCCTAAGGCTGCTTCTCAGGAAGATCTCAAAAAGGCT
TATCGTAAAGCTGCTATCAAAAATCACCCTGATAAGGGAGGCGATCCTGAGAAGTTTAAAGAGCTTGCTCAAGCTTATGAGGTCTTGAGTGACCC
GGAGAAGCGTGAGATATATGATCAGTATGGAGAGGATGCTCTAAAGGAAGGAATGGGTGGTGGAGGTGGTGGACATGACCCATTTGATATATTTC
AATCATTCTTCGGTGGTGGTGGAAACCCCTTTGGTGGTGGTGGAAGCAGCAGAGCTCGTAGACAAAGAAGAGGAGAGGATGTTATCCACCCGCTC
AAGGTTTCTTTAGAGGATCTTTACAATGGGACATCAAAGAAGCTTTCACTATCTCGCAATGAGTGTAAGGGTACTGGTGAGATGATCAGTGACAA
AGATAGGTGCCCTCAGTGTAAGGGTGAGAAAGTTGTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E318137] SGN-U593428 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T129680 [Download] [View] Facility Assigned ID: TFAEL81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0025 Quality Trim Threshold: 14.5