EST details — SGN-E318650

Search information 
Request: 318650Match: SGN-E318650
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123227Clone name: cTOB-9-P2
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E318650Length: 529 bp (755 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E318650 [] (trimmed) ACTTACAGGTTCGAGAAATTCGTCAAATTTGGCCGGAAAAAATGGCTTCCGACGAAGGAACCAATTTAGATTCATCTCGGTTGAAATTTGGGACA
CCGGAGGCGTTGGAAGAGGTGCGGAATCTCACTGACGTTGGAGACATGACTAGACTTCTCCACGAGTGCATTGCATATCAACGAGCCCTAGATCT
AGAACTGGATACTATCCTTTCACATAGATCTGACCTTGACAAGCAGCTTTCCGGCCTTCAAAAATGCGCTCAAGTTCTCGACATTGTTAAAGCTG
ACGCGGATCACTTATTCTCCAACATCAGTTCAACTTCTCTCCTTGCTGATCAGGTAAGCGCAAAAGTCCGTCAGCTCGATCTAGGTCAGTCGCGT
GTTAACGACACTCTCCTTCGAATAGATGCTATCGTTGATCGCTCTAATTGTTTAGACGGTGTACGTAAGGCACTTGCATCTGAGGACTTTGAATC
TGCTGCTAATTATGTTCAGACGTTCCTTCAACTTGACGCTAAGTACAAGGATTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E318650] SGN-U584770 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T131020 [Download] [View] Facility Assigned ID: TFBBJ85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0053 Quality Trim Threshold: 20.5