Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E319261

Search information 
Request: 319261Match: SGN-E319261
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C119172Clone name: cTOB-16-A10
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: Alias clone SGN-C182756 is on microarray TOM1: SGN-S1-1-7.3.5.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182756 [TUS-40-G10] Trace: SGN-T187853 EST: SGN-E375959 Direction: 3' Facility: INRA
Clone: SGN-C182756 [TUS-40-G10] Trace: SGN-T187854 EST: SGN-E375960 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E319261Length: 560 bp (767 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E319261 [] (trimmed) GCTTCACAAAAAACATGATTGTTGAAGATAGCAAGAAAGAGCAACATGTTGTACAAGATGATAATAGCCATGGGAGTAGCAATTCAGCTACTCCA
TCAGATGATCTTAGTTTTCGAAACTTATCGAAGCTCATTCTCCCTCCTCTTGGTTCCAATGATTCCAACACAAATCAAACTCACGAGAAAGGATT
TATCATCACTCCTATGGATTCAAGATACAGGTGTTGGGAGAGTTTAATGGTAATAATGGTGGCATATTCTGCATGGGTATGTCCATTTGAGATAG
CATTCATGCACTCCAATCCAAACACAGCTTTATACATAACAGACAACGTTGTTGATATCTTCTTTGCTGCTGATATCTTCTTAACTTTCTTTGTT
GCTTATATTGATGCTACAACTCAACTCCTTGTACGTGACAGGAGAAAAATTGCTATAAGGTACGTAACATAGACTCTCAATCTGATTTGATTTGA
TACAGAGATTAAGATATTAAATGATAATTTTCAATTTTATAATTCTAAATTAAAGTTATGTTAAATGTATTAAAATACCATTTAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E319261] SGN-U562828 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T132736 [Download] [View] Facility Assigned ID: TFBCJ05THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.953 Expected Error Rate: 0.0076 Quality Trim Threshold: 14.5