Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E319555

Search information 
Request: 319555Match: SGN-E319555
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C119049Clone name: cTOB-15-J11
cartOrder Clone
Library Name: cTOBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 3-8mm flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E319555Length: 288 bp (766 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E319555 [] (trimmed) GCTCCGGCCGGGGATAATTCCCACCAAAAGCTGCCATGGTTAATTTTAAAGCTCTTTCCGTTAATCTCCTCCTATTAGTATTACTATGTCCGGCG
TCAGCTCAGCCATCAAATTCCCCTGATTCCGAGAATCGGTTCGAGTACCCGAGTGTCAGTCCTGCTATGGCAATTATCATAGTGATACTTATTGC
TGCTCTTTTTTTCATTGCCTTCTTATCAATTTACATACGCAACCGCGGTGCAGTTAACGGAAGCATAAGTCAAACCTTCTTCATGCTACGGGATA
CTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E319555] SGN-U568090 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T132522 [Download] [View] Facility Assigned ID: TFBCG54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0265 Quality Trim Threshold: 14.5