Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E324899

Search information 
Request: 324899Match: SGN-E324899
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C123381Clone name: cTOC-11-H20
cartOrder Clone
Library Name: cTOCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: 8mm to pre-anthesis flower buds from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E324899Length: 641 bp (896 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E324899 [] (trimmed) CGCCCACATGCATTCAATGGGTGGTCCAAAATTTACTCATGGAAATATAAAGTCCTCAAACGTGCGACTCAAGCAAGATATGGAAGCTTGCATCT
CAGATTTTGGTTTAGCCCCTATAATGAACTTCCCTGCAGCCCCATCCCGATATCCAGGGTACCGGGCTCCTGAGGTGATAGAAAGCCGAAAGCAT
AGTCATAAATCAGATGTCTACAGCTTCGGTGTGTTACTACTCGAGATGCTTACTGGTAAGCAGCCAATGCAATCACCGGGGCGTGATGACATGGT
TGACCTTCCTAGGTGGGTCCAATCAGTTGTCAGGGAGGAATGGACATCAGAGGTTTTTGACGTCGATTTGATGAGATTTCAAAACATTGAAGAAG
AGATGGTACAAATGCTGCAAATTGCTATGGCATGTGTTGTAAAGGTCCCAGACATGCGACCCAACATGGAGGAAGTTGTTAGAATGATTGAAGAC
GTCAGGCAATCTAACTCCGAAAACAGGCATTCTTCAGAAAGAGAATAGATCCTATGATTCAAATGTGCATATCCCTTGATTCCTTGGATTTCTGA
CTTACAATTTGCAAGTGCAGAGAAGTTCATTCGATTTCGATTACCCAGTGCAACAACATACATGTTTTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E324899] SGN-U585293 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T137824 [Download] [View] Facility Assigned ID: TFCBR46TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5