EST details — SGN-E330377

Search information 
Request: 330377Match: SGN-E330377
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C133028Clone name: cTOD-4-I7
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C182915 is on microarray TOM1: SGN-S1-1-8.2.5.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182915 [TUS-40-N1] Trace: SGN-T195449 EST: SGN-E394123 Direction: 3' Facility: INRA
Clone: SGN-C182915 [TUS-40-N1] Trace: SGN-T195450 EST: SGN-E394124 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330377Length: 425 bp (842 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E330377 [] (trimmed) CATCAATTTATATGTTTCCTAGCAATGATATCTCTTATGATTATCAATATTATTGCAACAATGCATGCCACCCTGATGATCTCAAAGGTCTCAAT
GACTTCAAAGCTGGCATACATTCTGATACTTCAGGCAGACTAAGCAAATGGATTGGCCAAGATTGTTGCAATTGGCCAGGCATTTCTTGCAACTC
TACAACTTATAGAGTTGTACAAATCTATTTACCTGGTCACTATGTATCTGGTGACGATGAATCTCCAAACTTCGTGTCAAGTACAATGAGTGGTT
CAATCTCCCCTTCAATTTCACTTCTCACTTCACTACAAGTTATTGATCTTAACAAACTAGTCGGACTAACTGGGCAAATTCCTGAGTCCATTGGG
GTTCTCAAGGATCTCAAAGAACTCAACTTACAAACCAATCAAATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330377] SGN-U566122 Tomato 200607 Build 2 154 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T142542 [Download] [View] Facility Assigned ID: TFDAM52TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0239 Quality Trim Threshold: 14.5