EST details — SGN-E330714

Search information 
Request: 330714Match: SGN-E330714
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C134237Clone name: cTOD-8-I14
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330714Length: 602 bp (719 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E330714 [] (trimmed) ATGATATTGAATATACTGCATTGGTATTTAGGTGCATTCATTTTCCTGATACTTTTTCAGTTAATACTGTTATAAAATCTTATGCTTGTAGTACT
TTGCCTGATAATGCTGTAGTTTTCTATTACCAAAGGCTTAAAAATGGATTCTTGCCTAATAGTTTTACGTTTCCACCTCTCATGAGTGCTTGTGC
TAAAACGGGTAGTTTGGATTCGGGCCAGAAGTGTCATGGACAAGTTATGAAAAATGGTGTTGATGGAGTTTTACAAGTGCAGAACTCTATAGTGC
ATTTTTATAGTTGTTGTGGTTTTATTGATCTTGCTAGGAAGGTATTCGATGAAATGCACCAGAGGGATGTTGTGTCTTGGAACAGCATTATGAAT
GGATATGTAAAAGTGGGTGAATTAGTCGTTGCGCGACAGTTGTTTGATGCAATGCCAGAGTGTAATTTAGTTGGGTGGAACGTCATGATGACTGG
GTATTTGAATTCGAATAACCCTGGGAAGTGCCTAAAGTTGTTTAGAGAAATGGTACAGAGGGGAATGAATGGGAATGATACAACTATAGTTATTG
CTGTTACTGCTTGTGCTAGGTCAGCTCGAATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330714] SGN-U599927 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T143788 [Download] [View] Facility Assigned ID: TFDBD55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0006 Quality Trim Threshold: 20.5