EST details — SGN-E330906

Search information 
Request: 330906Match: SGN-E330906
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C128994Clone name: cTOD-10-A20
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: Alias clone SGN-C182834 is on microarray TOM1: SGN-S1-1-1.2.5.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182834 [TUS-40-J16] Trace: SGN-T196477 EST: SGN-E395151 Direction: 3' Facility: INRA
Clone: SGN-C182834 [TUS-40-J16] Trace: SGN-T196478 EST: SGN-E395152 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E330906Length: 506 bp (1093 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E330906 [] (trimmed) GGCTTATGGATTCAATTATGCTAATGTGACATTGGGTGAAGAGTTTTATAAAGGATTTGTATCATATCTCGCTAAAGGAAAAGGTAGCCCACGTC
GCCCTGGAAATGTTGAGGCGTACATATTTGCCTTATTTGATGAGGATAGGAAGAGCACACTCCCAGGAAACTTTGAGACACATTGGGGACTTTAC
TATGACGATGGAACGCCAAAGTTCCCTCTTGATCTACATGGAAATAAAAAGAATCTTGTGCCCGTGCCAAATGTAGAAAAACTCTCCAAAAAATG
GTGTGTGATCAAGCCGGATGTTAAGAACTTTACAGATGTTATGACATATGCTTGTGACCGTGCAGATTGTACACCTCTTACTAATGGATCATCTT
GCCAAAACCTTAATGACGCTGCCAAGGCTTCATACGCCGTGAATGCCTATTTCCAAAACAGCCAACAAAAAGATGATAGTTGTAATTTTGAAGGC
AAGGCAACAGTAACCACAAAGGATCCATCAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E330906] SGN-U572591 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T144256 [Download] [View] Facility Assigned ID: TFDBL10TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0132 Quality Trim Threshold: 14.5