EST details — SGN-E331209

Search information 
Request: 331209Match: SGN-E331209
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C133674Clone name: cTOD-6-K13
cartOrder Clone
Library Name: cTODOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: flowers
Development Stage: anthesis-stage flowers from full grown plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E331209Length: 560 bp (958 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E331209 [] (trimmed) GTTGGATAGCGTCACTCAGTAAGTGAAGCAACACAGATTGAACTGTTTCAAGTGGTATCAATTTTCAGATCTGGCATTTCTTTTGTCCAGTCAAC
ATACCCTTTCAAGTGCTTGGAGTTGTATTACTCTACAAACTAACTACACTGGGACTTGACTATGTTTTTGACAAGCAATGTCCACTGTGCTCCTC
TGCATGTGTCTTCTCTATCCCAATTGAACTCCCAAAGTGTCTTTTCTGTGAAGTACGCTGTAAAGTTGTTGAAAAAGTTAGCTGATGACGGGAAC
TTCAAATTGGGAAAAGTTGTCCATGCGCTTCTTATTGTATCTAATCATGCCTCAGAAAACCACGTAATTCAGAATAATTGTCTCATTAATCTCTA
CTCAAGGTGTGGACAACTTTCTATTGCTCGGCACATATTCAACAGATTGCGGCAACGAAATATAGTTTCTTGGAGCACTTTAATGACAGGATATT
TGCACAATGGGTTTACTTGGGAAGTACCCAAATTGTTGAAAGACATGGTTTCAGTGGATAATTTATTTCCAAATGAGTATGTCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E331209] SGN-U602619 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T143180 [Download] [View] Facility Assigned ID: TFDAU67THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0033 Quality Trim Threshold: 14.5