Notice: SGN will be briefly unavailable for maintenance. Apologies.

EST details — SGN-E338666

Search information 
Request: 338666Match: SGN-E338666
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C135814Clone name: cTOE-15-D18
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E338666Length: 500 bp (677 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E338666 [] (trimmed) GTGAAATGTGCTGATGTTCATCCCCTTCAACTGCCTTGTTGCTCAACTCTCAAAGCTGAAGCTTCCAATCTCAAGAACCAAAGAGCTTCACGCTT
TCATAATCAAGACTCATCTCTCACAAGACCCATTTTACGCTACAAAAATTATAAGATTCTATGCTCTAAACAACGACATCATCTCTGCACACAAA
GTGTTTGATAAAACTCCTCATCGAACCATTTACCTCTGGAACTCCTTAATTCGAGGTTATGCCAGAGCCCACAAGTTTAGAAATGCATTTTCGCT
GTTTAATGATATGCTTCATTCTCAAATAATGCCTGATAACTTCACTTATGCATGCCTTGTAAAAGCCAGCTCTGAGAATTTTGATTTGCACAGCT
TGAGAGTTTTACATGGAGGGGTTGTTCTATCTGGGTTGCGGTTGGACTTTATCTGTAGTAGTCAACTTGGTAGTGCTTATTCAAGATTAGGCTGT
ATAGCTGATGCAAGCAAGGTGTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E338666] SGN-U601618 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T150929 [Download] [View] Facility Assigned ID: TAICH21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0087 Quality Trim Threshold: 14.5