EST details — SGN-E340795

Search information 
Request: 340795Match: SGN-E340795
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C147694Clone name: cTOF-5-K24
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181683 is on microarray TOM1: SGN-S1-1-8.2.12.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181683 [TUS-37-J17] Trace: SGN-T194055 EST: SGN-E392729 Direction: 5' Facility: INRA
Clone: SGN-C181683 [TUS-37-J17] Trace: SGN-T194243 EST: SGN-E392917 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E340795Length: 414 bp (938 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E340795 [] (trimmed) GCAGGTTACTTGAAGTTCATTAGCAATTTAGAGAACCAGATACTAAACGTCTCCATGGAAAGGGAGACTGCGAAGATTGAAGTGATGAGAGCTCA
AGCTATGATCAACATTCTTCAATCACGTCTCGATTTCTTGAACAAGGAGAACGAGGACTTGAGGGGACTCATTCGTCGAGGTTAGATGGTAACAA
CAACTCCAAAGTAATGCTAGTTATGCAGCAACTGTTGGCCGGGCAGAGGGCTCCGTTGTATCGGAGTCCTCAATTAGTAGAACTGTCTTTTAAGT
TAGAAGAAACTGAAAATGGCTAGCTATGTAATAAGTTTATTTACCTAGTTTTGCTATAAACTTGTACCTATGATGCTATCGACATAATGTCGTAT
GTTTAACTAGTTATAAATAAAGTGCCTTCAGTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E340795] SGN-U583456 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T153818 [Download] [View] Facility Assigned ID: TOFAR72THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0069 Quality Trim Threshold: 12.5