EST details — SGN-E341292

Search information 
Request: 341292Match: SGN-E341292
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C137459Clone name: cTOE-22-J5
cartOrder Clone
Library Name: cTOEOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Crown gall
Development Stage: crown galls from full-grown plants (4-8 wks old)

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E341292Length: 518 bp (972 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E341292 [] (trimmed) CTTATTCAGGTTTTAAATAGCCATGGATGATAGTGGATATGGGGAGTTTTTGAACTATATTGGTCCTGACCCACAGTCTGATCAGGAAAGTGATA
GGGAAGAGGAAGACGATGAGCTGCCTGATAGGAGTGATGATGAGAGAGCTGTATCTGATGATGAGCAGCCTGGTGCTTCAAATGGATGGCTTGCC
ACTCAAGATGATATTGACATGGATAACCAAGTTGTTCTTGCTGAAGACAAGAAATACTACCCAACTGCTGAAGAGGTTTATGGTGAAGAGGTTGA
AACGTTGGTCATGGATGAAGATGAACAGCCACTTGAAATGCCAATAATTAAACCAGTGAAGAATCTTAAGTTTGAACTTGGGGTGAAGGATTCGT
CCACTTATGTATCGACTCAGTTTCTCTTAGGTCTGATGTCAAACCCAGCATTGGTTAGAAATGTTGCTCTAGTGGGACACATACATCACGGGAAG
ACTTTGTTTATGGATATGCTGGTGGAACAAACACACCATATAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E341292] SGN-U571128 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T152481 [Download] [View] Facility Assigned ID: TAIDI51TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0151 Quality Trim Threshold: 14.5