EST details — SGN-E342377

Search information 
Request: 342377Match: SGN-E342377
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C148584Clone name: cTOF-8-L14
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E342377Length: 630 bp (892 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E342377 [] (trimmed - flagged) GCATCCATATATCGGGTTACCCAAAGAAGCAAGAAACGTTTGCTAGAATATCTGGCTACTGTGAGCAAAATGACATCCACTCACCTTGCTTGACC
ATTCTTGAATCACTACTGTTTTCTGCTTGGCTACGTTTGCCATCAGAGGTTGACGTAGAGACACAAAAGGCATTTGTTGACGAGGTAATGGAGCT
TGTGGAGCTGAGTCCACTAAGAGGAGCTTTGGTTGGTTTGCCTGGAGTTGATGGACTGTCAACAGAACAAAGGAAACGGCTAACAATTGCTGTTG
AACTAGTAGCTAACCCTTCTATTGTGTTCATGGATGAACCTACATCTGGATTGGATGCAAGAGCTGCAGCTATTGTAATGAGGACTGTACGTAAC
ATTGTGAACACCGGCCGAACAATTGTTTGCACAATCCACCAGCCCAGCATTGACATTTTTGAATCATTTGATGAGCTNTTGTTTATGAAGCGTGG
AGGAGAGCTCATTTATGCAGGACCTCTTGGTCCTAAATCTTGCCAGTTGATAGAGTATTTTGAGGCAATTGAAGGAGTACCCAGAATAAGACCCT
GGATATAATCCAGCTCATGGGATGTTGGGAGGTTACCTTCGTCAGTAGAAGAAACTCGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T154776 [Download] [View] Facility Assigned ID: TOFBF67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Problems: Possibly chimeric (ends match significantly different genes in arabidopsis)
Sequence Entropy: 0.983 Expected Error Rate: 0.0100 Quality Trim Threshold: 14.5