EST details — SGN-E3433

Search information 
Request: 3433Match: SGN-E3433
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111230Clone name: cLPT-7-P18
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C111230 [cLPT-7-P18] Trace: SGN-T179019 EST: SGN-E367457 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E3433Length: 582 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E3433 [] (called/trimmed by facility)
GAACTAGTCTCGAGTTTTCAGTTCACAGAGTGAAGAAACTAAGGTCTTTGACTCCTGGTATTTTTGCTCTTGCTAATCATCACTTTTCAGTTGCT
ACGGAATCCTCATGGAAGCATCGAACTTCCATCAGAGTTCCAAATTTAATTGGTGGCAGCTTTGTAGATTCAGAATCATCAGAATTCGTTGATGT
TATAAACCCAGCAACCCAAGAGGTGGTTTCTCAGATACCTTTAACAACGGATAAAGAATTCAAATCTGCGGTTTCTGCAGCCAAGGAGGCTTTTC
CGTCATGGAAAAACACACCCATAACCACAAGACAACGGGTCATGCTCAAATTCCAAGAGCTTATTAGGAAGAACATGGATAAGCTTGCCTTCAAT
GTGACTACGGAGCAGGGAAAAACACTGTAAGATGCACAAGGGGATGTGTTCCGCGGTCTTGAGGTGGTGGAGCATGCGTGTGGAATGGCAACTTT
GCAGATGGGTGAGTATGGGTCTAATGTATCAAAAGGAATTGATACCTATAGCCTAAGGGAACCTCTGGGTGTTTGCGCCCGGATTTGTCCATTCA
ACTTCCCTGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T179019 [Download] [View] Facility Assigned ID: TPTBB93TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence