EST details — SGN-E345215

Search information 
Request: 345215Match: SGN-E345215
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C140958Clone name: cTOF-13-O7
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C181524 is on microarray TOM1: SGN-S1-1-7.4.12.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C181524 [TUS-37-D2] Trace: SGN-T194365 EST: SGN-E393039 Direction: 3' Facility: INRA
Clone: SGN-C181524 [TUS-37-D2] Trace: SGN-T194366 EST: SGN-E393040 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E345215Length: 657 bp (920 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E345215 [] (trimmed) ATTTTCTTTTCGTTTCAAAGGATGAGAACTCTCCTTTAAAAGCCATTGACTTTGGTCTCTCTGATTATGTAAAACCAGATGAAAGGCTTAATGAT
ATTGTCGGAAGTGCATACTATGTTGCACCTGAGGTTTTGCATAGATCTTATGGAACAGAAGCTGACATGTGGAGTATTGGTGTCATTGCATACAT
TCTTCTTTGTGGAAGCAGACCTTTCTGGGCTCGGACAGAGTCCGGTATATTTAGGGCCATCCTGAAAACTGATCCAAACTTTGATGAAGCCCCTT
GGCCCTCTTTGTCTTCTGATGCAGTGGACTTTGTAAAAAGATTGCTGAATAAGGATTATCGCAAAAGGCTAACTGCAGCTCAGGCTCTCAGTCAT
CCTTGGTTGGCTGGTCATCATGATATGAAGATTCCTTTGGATATGATAGTATATAAGCTTGTAAAAGCTTATGTATATTCTTCTTCTCTTAGAAA
AACTGCTTTAAGGGCTCTTGCTAAGACATTGACTATACCACAACTAGCTTATCTTCGTGATCAGTTTACACTATTAGGGCCAAGCAAAAGTGGAC
TAGTAGCTCTACCAAACTTCAAAATGGCTGTGATGAAGAACTCCACCGATGCGATGAAGGATTCAAGGGTTTTCGACTTTGTTAATA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E345215] SGN-U565668 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T156091 [Download] [View] Facility Assigned ID: TOFBW88THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0049 Quality Trim Threshold: 14.5