Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E346436

Search information 
Request: 346436Match: SGN-E346436
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C143461Clone name: cTOF-23-D5
cartOrder Clone
Library Name: cTOFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: shoot
Development Stage: developing shoots from 4-6wks old plants

Microarray: Alias clone SGN-C184614 is on microarray TOM1: SGN-S1-1-5.4.14.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184614 [TUS-45-D20] Trace: SGN-T198790 EST: SGN-E397464 Direction: 5' Facility: INRA
Clone: SGN-C184614 [TUS-45-D20] Trace: SGN-T200059 EST: SGN-E398733 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E346436Length: 650 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E346436 [] (trimmed) GGAGCTTTCAACACTCAAGAGATCGGAAGAAACTGAAATCACACAGAGCCCAAATTTTTCAATAGCTTTTAGTACTATCAGATAATGGCTAGATA
CGACAGAGCGATCACCGTTTTCTCGCCGGACGGCCACTTATTCCAAGTGGAGTACGCCATGGAAGCCGTACGCAAAGGAAACGCCGCCGTCGGTG
TACGTGGAACTGACACTGTTGTCCTCGGCGTCGAGAAGAAGTCCACTCCCAAGCTTCAAGACTCCAGGTCAGTAAGAAAGATAGTGAATCTAGAT
GATCACATTGCGTTGGCGTGTGCTGGGCTGAAAGCAGATGCACGAGTTCTTGTGAATAAAGCACGCATTGAGTGTCAGAGTCATAGGCTTACAGT
TGAAGATCCTGTTACTGTTGAGTACATAACTCGTTACATTGCTGGTCTTCAGCAAAAGTACACCCAAAGTGGTGGGGTGAGGCCATTTGGTCTAT
CCACCTTGATCATTGGTTNTGACCCACACACAGGTGTCCCCTCACTTTACCAAACAGATCCATCAGGTACATTCTCAGCTTGGAAAGCCAATGCG
ACTGGTAGAAACTCCAACTCTACTCGGGAATTCTTGGAGAAGAATTACAAAGAAACATCTGGCCAGGAAACTGTGAAACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E346436] SGN-U581550 Tomato 200607 Build 2 47 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T158713 [Download] [View] Facility Assigned ID: TOFDM15TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.990 Expected Error Rate: 0.0064 Quality Trim Threshold: 14.5