EST details — SGN-E34701

Search information 
Request: 34701Match: SGN-E34701
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C21150Clone name: cLED-31-N1
cartOrder Clone
Library Name: cLEDOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: ovary
Development Stage: 5 days pre-anthesis to 5 days post-anthesis

Microarray: Alias clone SGN-C181565 is on microarray TOM1: SGN-S1-1-6.1.12.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C21150 [cLED-31-N1] Trace: SGN-T56729 EST: SGN-E242810 Direction: 5' Facility: TIGR
Clone: SGN-C181565 [TUS-37-E19] Trace: SGN-T199300 EST: SGN-E397974 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E34701Length: 609 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E34701 [] (called/trimmed by facility)
TGGGATACTTTGCAAGTTACTGTACATTGTGTTAAAACAACAACATGGAATAAAGGTTAAGTAATTGCAGCTAAAAGAGCTGTTCCATTCATGTT
TCAACTTGCTAAAAGTTTAGAAAATCAGAAGTTACGAGATGGTCAGAGCTTATTCACAAGAGCACACATATAAGCATCCATGGGAAAGAGTAACT
TCTGCATCCTGGCGCAAGTTTGCTGATCCTGAGAACAAGCGCATTCTATCGCATATCCTCGAAGTTGACACATTGAACCACAAGCTTGATTCCAT
CTCAGGGAGGCTTTATACGACTCGTGCCATAACTATTCATGCACCAGGACCATGGTTCCTCCGCAAAATCATTCGTCAAGACATCTGCCACTGTG
TAGAATCAACTGTTGTTGATGCCCAATCTCGGTCCATGCAGCTCTCCACTCGAAACATTAGTCTGGAGAAGTACATAGAAGTGGAAGAGAAAATC
AGATATGACCCTCATCCAGATAATCCAAAGTTATGGACCGTCTGCAAGCAGGAAACGAGTATCAGGATTAAGCCCTTATCAGCACTGGCTTCAAT
GGCAGAGAAAATTGAACAGAAGTGTGTGGACAAGTTTCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T56729 [Download] [View] Facility Assigned ID: TOVES73TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence