EST details — SGN-E349228

Search information 
Request: 349228Match: SGN-E349228
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C165086Clone name: cTOS-2-D3
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E349228Length: 673 bp (928 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E349228 [] (trimmed) GGCTTAATCAATGGCGGATTCATCAGAGGGTGAGGAAGAAGGGAAACTAACAGGAGGAAGCCAGCAGTTAGTTGTGGATGATGATCTCCGGGAGA
TGGGTAAAAAAGCAGCTTGGAGTGTCAGCTCTTATAAACCTGGCAATGGAGTTCTTTCACTTCGCGATGATAACCTTGAAACCTATTGGCAATCA
GATGGTGCACAGCCTCATCTTGTTAATGTTCAATTTCAGAAAAAAGTTAAGCTTCAATTAGTCGTCCTGTATGTTGATTTCAAGCTTGACGAAAG
CTATACACCTGGTAAGATCTCTATCCGAGCAGGCGATGGCTTTCACAACTTGAAGGAGATAAAAGCAGTGGAACTTGTGAAGCCAACTGGATGGA
TGCATATATCTTTATCTGGTAATGATCCGCGTGAAACTTTTGTCAACACTTTCATGCTGCAAATAGGTGTGCTCTCGAATCATCTTAATGGAAGG
GACACTCATATCCGCCAGATAAAAGTCTATGGGCCAAGACCGAACCCTATCCCTCTTCAGCCATTTCAGTTCACTTCTACAGAGTTTATTACTTA
TTCTGCTGTGAGATGAAGCTCAAGGGACTATCCCAAGAGGAAAGATGCCAACCATATTTATCGATATCAAAATGCCACAATTTTGCCATGAAAGT
TAAAGAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E349228] SGN-U565675 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T162184 [Download] [View] Facility Assigned ID: TSCAG14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0057 Quality Trim Threshold: 14.5