EST details — SGN-E349426

Search information 
Request: 349426Match: SGN-E349426
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C163186Clone name: cTOS-1-P5
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E349426Length: 397 bp (909 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E349426 [] (trimmed) ATTCTAATGTTAGTTTACAGCAGCAGATATTGTCAATGCAGCAGCAGCAACAACAACAACATCAGCAGTTCTTGGATCCTATTAATGGGATTCTT
AATGTTGGGAGCTAAGTGATTTAAGGGTCTAAGGATGCGAACAACCAAGCTAAATAATTTAAGGGGCTAAGGATGCAAACCAAGCTTAAGTATGA
ATCTGGTGGAATTTAAGAGCTTGCTAATTGGAAAAGAGCGGGTCCAATGAAGACACACTAAGTTATGCCTTTCATATTCTCAACATGTACTGCAC
ACGTTTATTCCATCTACGTTTATATTAAAATTTTGTGTATACACATTCTTGAAATAAAGGTTGAAAAATGAAACATAAAAGTATTGAAGTGAAAA
TCTTTCTTATTTGGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E349426] SGN-U600988 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T161791 [Download] [View] Facility Assigned ID: TSCAC87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.938 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5