EST details — SGN-E352898

Search information 
Request: 352898Match: SGN-E352898
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C160169Clone name: cTOS-11-L21
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E352898Length: 796 bp (906 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E352898 [] (trimmed) GCTTTGTTGAACAAGCGGGTGTTCAGAATTAAGACAAAACAAGATAGATACAGAAGGTTCCAAGATCATTTAGTGATTAAAGGATATTCACAAAG
GAAAGGTGTTATTGAAATATTTTCTCCTTTTGTGAAGTTAACCTCTATTCGAATTCTGTTGAGTATTGTTGCATCGGAGAATTTGCATCTAGAGC
AAATGGATGTAAAAACAACGTTTTTACATGGAGATCTGCACAAAGAGATATATATGAAACAACCGGAAGGATTTTTGGTTCCAAGCAAGGATAAC
ATGGTATGAAACCTCACCAGGAACCTTGTATGGACTAAAGCAAGCACCAAGGAAGTGGTACAAGAAGTTTGACTCCTTCATGACCAAGAGTGGAT
TCTACAAAACTGAAAAGGATCCTTGTTGTTACTTCAAGAAATACACTGATTCATATGTCGTTCTACTCTTGTATGTGGATGATATGTTAATTGCA
GGATCTTTTATGTGGGAGATTAAAAATCTAAAGACAACGTTGTCTGCAGCAATTGAAAGATTTGGGTCCAGCGAAGCAGATTTTGGGGATGAAGA
TTTCCCGGCATAGATTTGCTGGCACTTTAAATCTATTTCAGGTGTTGTAAATTGAGAAGGTGCTGAGCAGATTCAGGGTTAATGATTCTAAGCCC
AAGACTACTCCATTAGAAAATCACTTTAAATTGTCAAAGGAGAAGCGCCCCAGAATGGCAATGGAGTGTGATCATATGGCACTTGTTTGATATGC
TTTCAGCAGTGGGAGATTGATGTATGCTATGGTCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E352898] SGN-U598241 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T165218 [Download] [View] Facility Assigned ID: TSCBQ71TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0124 Quality Trim Threshold: 14.5