EST details — SGN-E352911

Search information 
Request: 352911Match: SGN-E352911
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C159957Clone name: cTOS-11-B10
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E352911Length: 476 bp (905 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E352911 [] (trimmed) GGTAAGTTTCCTACCCTTGTTTCCCACCAGGAATCACTCGAGTCTAAGGTAAACGAGACCAAGGCGACTATCAAATTCCAGTTGAAGAAGGTTCT
TTGCATGGGAGTTGCCGTAGGTAATATGGATATGGAGGAGAAACAAATCTTCCAGAACGTGCAGATGAGTGTCAACTTTCTCGTGTCCTTGCTAA
AGAAGAATTGGCAAAATGTGAGATGCTTGTACTTGAAGAGTACCATGGGAAAGACTCAACGCATCTTCTAAGGACATTGTATTACAATCTTTGCA
GTTTCAGGCGTTTTGACTTGTACGCGTTATAGATACTATTGCATTTTTTGGTTAGTTGTGCTCCTTGGATACTGAGTTGAAAACTTTATATCAGT
TTTGGTATGAATTTACCTTTTCCTTTCTCCCTTCCGGTGAATTTCCTGAATATTGGCAACTTTCATATCTAAAGGAAAACTCCAATTTTGTGGTT
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E352911] SGN-U592293 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T165231 [Download] [View] Facility Assigned ID: TSCBR05TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0127 Quality Trim Threshold: 12.5