EST details — SGN-E354679

Search information 
Request: 354679Match: SGN-E354679
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C103132Clone name: cLHT-5-D14
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193688 [TUS-68-N22] Trace: SGN-T346696 EST: SGN-E545821 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193688 [TUS-68-N22] Trace: SGN-T346697 EST: SGN-E545822 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E354679Length: 302 bp (1002 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E354679 [] (trimmed) AGTGGCTCTGTTTTCAACTAATCAACTTCAGGACCCCTGTTTTTCTCTTTATCTGCAAAATTTCAAGTAGCATTAAATAAATTTTGCTCATAAAT
TCTTCTTTTCTTCATCTTAAACTTTAAAATACAACAAAAGACACTTGCTTGTAGACAAACTACACCTCCAGGTACTCAATTTCAACTTTTTGTTA
ATACTCATTTTGTTATTTTCTGCTAAATTGTTTACTTTACAATGGGAATTTTGATGTACATAGCAAGATCTGTGTGTATTTGGAGTTGTCTTTTT
GGGATTTCTACTGCATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E354679] SGN-U578212 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T169895 [Download] [View] Facility Assigned ID: THTAT19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.894 Expected Error Rate: 0.0012 Quality Trim Threshold: 14.5