EST details — SGN-E356200

Search information 
Request: 356200Match: SGN-E356200
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C163258Clone name: cTOS-20-D17
cartOrder Clone
Library Name: cTOSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: suspension cultures
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E356200Length: 552 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E356200 [] (trimmed) CAGCTGAATCAATAAGATCAACTCCTGTCAAATCTTCTAAGGAATCTGACGGTTTCAGTAACAGCTTTGTAAATAAACCATGTACGACGTCCCCA
TATACAAGGGTGATGGATAAGGTTTATAGTAGTAGCGACCAGAAGCCGAGGAAGGTAGCCAATGGAGCGGAGCCAAGGAGATGACAGAATGTTGA
AGAGCGAACTGATTATGCAGTGAATCAGACAAGAACTGTTACTGTTGCATTTGTCTATTCCTTCTAACTGCTGTTCGACATGCAAAATATGGTAG
AATCTGTATAGCCTGTCACATGGAAGAAATGAATGTTGTAATCTTATGCTGGGCTGGGTGACTTGGGATCATTGTGCTTGTACCATTACATGTTA
CATGGATGCCAGACACATCGATACGCTTTCAGCATTGCCTCAGTGTACATCATTGATGAGGCAATATGGTAGAAAAGTTCTCTATGTAGTCTCTG
GTATTCCGGAGGTATTCGTTACGTGTGTGTAAATGTATTCATTATGTGATATCTATGGTCAGGACATTTTCATACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E356200] SGN-U600983 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T167936 [Download] [View] Facility Assigned ID: TSCDA21TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0001 Quality Trim Threshold: 12.5