Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E358785

Search information 
Request: 358785Match: SGN-E358785
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C102370Clone name: cLHT-24-K16
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194046 [TUS-69-M20] Trace: SGN-T347311 EST: SGN-E546436 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194046 [TUS-69-M20] Trace: SGN-T350246 EST: SGN-E549371 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E358785Length: 240 bp (880 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E358785 [] (trimmed) GATTACTCTCCCGCCCAACTCCTTCCCTACTCCGCCGCCGCACCACCGGCACTACCGCCGCACCACCGCCAAGCCCAAACGAAAGCCCACTCATT
CTCCGTCTCATTTCACTTCATCCATCACTACTCCTCAATCTCCGCTCCTATCCTCATTTCGATGGGATTCCGCTTCCGCTTCAGCTGTAATAGTC
TTAAATACTATGCTGAGTTGGCGTCTAAGCTAGCGCAGGATGGGAGGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E358785] SGN-U597344 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T170345 [Download] [View] Facility Assigned ID: THTDP68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5