EST details — SGN-E359213

Search information 
Request: 359213Match: SGN-E359213
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C101050Clone name: cLHT-11-N23
cartOrder Clone
Library Name: cLHTOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C193782 [TUS-69-B20] Trace: SGN-T346857 EST: SGN-E545982 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C193782 [TUS-69-B20] Trace: SGN-T346858 EST: SGN-E545983 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E359213Length: 503 bp (869 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E359213 [] (trimmed) CACAATCGGAGAGAGAAACAGAATCCAAAGAACTCTCTCTCTCTAGCAGGAAAAAATGGCGTCGGATCGGAAAATTCATGCATTTGAGGAGGTCG
CTAAGCACAACAAGACCAAAGATTGCTGGCTCATCATCAGCGGAAAGGTTAAATCTCGCCCTGTTTTTTTTATTTGTTCTTTCGATTGATTAGAT
TTTAGTTTTTTCATGATCTGTGTGCTGATATTTTCCTGGCATTTTGAATCGGTTTGTTTTATGAGTTTTCTCGATAGATATATCTGAGTGGTTGA
AGTTGCTATCACATTGGAATTATCGAATTTTGGTGATAGCTTTGATTAGGTCTAGTTACGTTAATTTTACAATGCCAGTTGAATATTTGTTTTGC
AATTTTGAGTAGTTAACGTACTCCGTTTTGGACTTTCTTTGTACCTGGAGGTGTTTTGTTGAAGTGACCAATGGAATATGTGGGATCAGTGACTT
TCCTTAGACTCGACTGGAAAATACAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E359213] SGN-U592247 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T171415 [Download] [View] Facility Assigned ID: THTBQ84TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.947 Expected Error Rate: 0.0264 Quality Trim Threshold: 14.5