EST details — SGN-E360742
| Search information |
| Request: 360742 | Match: SGN-E360742 |
| Request From: web user | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C107969 | Clone name: cLPP-7-G23 |
| ||
| Library Name: cLPP | Organism: Solanum pennellii (formerly Lycopersicon pennellii) |
Tissue: pollen
Development Stage: pollen collected from open flowers
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C194433 [TUS-70-M23] | Trace: SGN-T347976 | EST: SGN-E547101 | Direction: 5' | Facility: INRA (MWG) |
| Clone: SGN-C194433 [TUS-70-M23] | Trace: SGN-T350355 | EST: SGN-E549480 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E360742 | Length: 180 bp (1041 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E360742 [] (trimmed)
TCAGATTGATCTGCTATCTTTTTTCTATCTCGATCCATGTCGGTTAAAACAGTGCAAGTGAACAATGTTTCTTTGGGTGCTAAAGAGCAAGATAT
CAAGGAGTTCTTCTCCTTCTCTGGGGATATTGAATATTTAGAGATGAAAGGTGAGAGTGAGCGATCACAAGCTGCTTATGTAACA
CAAGGAGTTCTTCTCCTTCTCTGGGGATATTGAATATTTAGAGATGAAAGGTGAGAGTGAGCGATCACAAGCTGCTTATGTAACA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E360742] | SGN-U572460 | Tomato 200607 | Build 2 | 3 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T173145 [Download] [View] | Facility Assigned ID: TPOAY48TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.951 | Expected Error Rate: 0.0148 | Quality Trim Threshold: 14.5 |
Working
