EST details — SGN-E362607

Search information 
Request: 362607Match: SGN-E362607
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C106103Clone name: cLPP-1-N19
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194258 [TUS-70-F16] Trace: SGN-T347675 EST: SGN-E546800 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C194258 [TUS-70-F16] Trace: SGN-T347676 EST: SGN-E546801 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E362607Length: 600 bp (934 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E362607 [] (trimmed) TTCAGCTTCACACTTTCAATTCTTACAAACATTAACATATCATACCAATATTTTCCAGTTATAGAAGGAGGAGAGAGCCCTAACCTATATTTTCA
TCCAACAAAAACTTTACCTATTACTACTATTTTATTTCACATAAAAACAAATTTGTTGTTTGTTCATTGGAATATTGTTGGAATTGTGTTACATT
TCGGAAAATTCTCGATTTGGGTATTAGGTTTGTTGTATTAATAGCATTTTACCCAAGTCCCTAAATTCCCAAATTATTGGAAATTGTGTTTATTT
CACAAAAGTATCCATTTGGGTGCAAAAGACAGAAATTTACAAGAAGAAAAAGGATTTGCTGTGTCTCTAAATTTACAAATTGGGCATATTTGGGG
TTTGTTTGCTTTTCTGTGCATTGTAAGATTGTTGGGGATTGTGTTTATTTCCCAAAATTCTCAATTGGGGTGTTTCTAAAGACTTGTTCTATCGA
TCACGAAAAGGCCTTTTTGTCATTTTATTGATTTATGTGTTCCATGGCAAGATTGTTGATTGAGGTTCAAGCTTTCATCACTGCAGCTATAAAGA
TTGGATAAAGACACAGATGCTTGAATTTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E362607] SGN-U566996 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T174668 [Download] [View] Facility Assigned ID: TPOAC82TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.925 Expected Error Rate: 0.0044 Quality Trim Threshold: 14.5