EST details — SGN-E364860

Search information 
Request: 364860Match: SGN-E364860
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C110316Clone name: cLPT-4-F3
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E364860Length: 557 bp (895 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E364860 [] (trimmed) TTGAAATTAGTTGCTACCACGAGCTATGCTCCTCTAGGGTGGATGGGGACTCGCATAAATGGATTGACGCTGGAAATCGAGGTAAAACAGATGAG
CTTGTAAGGAAGAAGAAGAGTAGAAGAAGTCATTCAGCTCCTCCATTTTACCAAGACAAGAAGGAGTTCTTTGCCACAAGTGAGTCTTCAAGAAA
GGTAGCAGGAAATAACATCTTTTAAACTGTTCATGATGTGCTCATGCCAGAATCTAGAGTTGTAAGGAGACTGCATCATTCTGCAGAAGCTATCT
GCGCGGAGCTTCCACTCAGTCTTCCCATCAATGTGCTCAATCTTCCACCCATAATGTGGTAAAGGGTGTGTTCTCTGTTGAAAGGTAATGTTATA
AAATTTCTTGGGAGGGTTGGGTCTCTTTCTGATATTATCTCAATAAAATATTTTAGTAATTCACACGACCTGATATTTCTCTATTTAGACCAAGG
GTTATAATGAAATTTGTTAACATCTGGAATAGAAAATTACAAACTCAAGGGGATTGCACAACTACACGCGATGGGGAGTCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E364860] SGN-U593405 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T178261 [Download] [View] Facility Assigned ID: TPTAO26TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0011 Quality Trim Threshold: 14.5