EST details — SGN-E365149

Search information 
Request: 365149Match: SGN-E365149
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C105111Clone name: cLPP-17-B23
cartOrder Clone
Library Name: cLPPOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: pollen
Development Stage: pollen collected from open flowers

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C194762 [TUS-71-K16] Trace: SGN-T348541 EST: SGN-E547666 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E365149Length: 419 bp (897 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E365149 [] (trimmed) TTAATAGTCGCAATGCAAAACTTTGGTAGTCGTCTCATTGATTGATCTACCAGCCCCCAGCAGCAGGAGGAGGAAATTGTGATGATGAAAACTAC
AAGTCATTGTGTTCCATATGTCTATCTGAATATGTAAAGGACAACACAATTGGTACACTCGGTTGTGGACATGAATATCACGCAACTTGCATACA
ACAATGGCTGCTGAGGGGCAAGAAGAATTGTCCAATCTGTAGATCTTCTGTTTAACAGAAACTTTACTTTTCTTTTTATCAAGTTGTTGTTATTT
GAACTTTTTAATATGAACAATTTTTTATTCAGTTTGCTATTTTTTATATGTATTGTTGGTGATTGAATTCACCTTCTAGAACAATTCTGCAACTC
AATTTATGGAATTATTCTTTACAAAAAAAAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E365149] SGN-U598811 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T176861 [Download] [View] Facility Assigned ID: TPOCO12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5