Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E366322

Search information 
Request: 366322Match: SGN-E366322
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C109824Clone name: cLPT-1-C23
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C109824 [cLPT-1-C23] Trace: SGN-T177746 EST: SGN-E366321 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366322Length: 529 bp (922 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E366322 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAAAAGGTACATTTATGTATTATATATGCCTTAATACTATTAAGCTTTGTTACATTTAAAAA
CAGAAAGGGAAAAAAAAGAACTGTCCCAAAATTTTTAAACAACTACTCACAACAAACAAACTACAACAAAAACTAAAGCTGTCCAAAGGAAGCAT
CCAAGAGACGATAATAATTTGTTGCTATTTGATCTTACAAAACTTGCTCTGTTGAGTGTTGAAATGTGTTGTACTGTTTTTATTGGCACTGTTTT
AGAGTCCCCACAATGTCCAATCCCTGAATCCAACAATGTCTTTAAATCATCTCCAAGCCCATTTTCTTTATTGTAACAAAGCCCATCATTGTTTG
AAAGCTTCATTTTCCTTCTCATTCTCCAAACCATGTCTCTTTTAAATGGAATAGGACCACTCAACATGTTATTATTTAGCCTAAGCTCACTTATG
TTATTTAAATTACCAAAACTCGATGGGATCGAGCTATTTAACTTGTTCCCATCG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366322] SGN-U602728 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177747 [Download] [View] Facility Assigned ID: TPTAA24TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0028 Quality Trim Threshold: 14.5