EST details — SGN-E366334

Search information 
Request: 366334Match: SGN-E366334
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C109854Clone name: cLPT-1-E23
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C109854 [cLPT-1-E23] Trace: SGN-T177758 EST: SGN-E366333 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E366334Length: 572 bp (937 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E366334 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGACATGAGACTTTATCATCAATATTATATGTATATACTATTAATACAGATACATTGT
CAAGAGGCATTTGCCTATTAACCAATGCAGAAATTAAAACTGAACACTGACTATTACACTGTTTTGATACACAATTACATTAGACAGAATGAAGT
AGAATAAGACGGAATTACATACCAATGAATACTAACAACATCGAGGCCACAAATCATCTGGTTTCATCGATCCTAAATTCTGAAAGAACCTTGCT
TTCAGTGACACTGACACAGCTTGTGCTTACATTTATAGAAGGTAAGCGATTTATACCAGGCAATGCCATTTGCCACGAAACATCGGATTTGGTAT
CCTCATGAGATTGTTGGGCCATTGTAGGGTGTTGAAGCTGTCGAGCGTAATTCAAGTCCCACAACACATTCATCATATTAGGCCTATCAGTGCCA
TTCTCTTGCAGACACTTCTCTGCTGTTTCTCCGAATTTCCTTAGGGAGTTTGGGTTAATTTTACCAACAAGAAATGGATCGATTATCTTTTCGAT
CT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E366334] SGN-U603322 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T177759 [Download] [View] Facility Assigned ID: TPTAA36TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0138 Quality Trim Threshold: 14.5