EST details — SGN-E367581

Search information 
Request: 367581Match: SGN-E367581
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C111124Clone name: cLPT-7-J4
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: Alias clone SGN-C185240 is on microarray TOM1: SGN-S1-1-3.2.11.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185240 [TUS-46-N22] Trace: SGN-T192283 EST: SGN-E390957 Direction: 3' Facility: INRA
Clone: SGN-C185240 [TUS-46-N22] Trace: SGN-T197619 EST: SGN-E396293 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367581Length: 528 bp (841 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E367581 [] (trimmed) ACAAATAATTGCTCTTACAATATTCTTATCAATGGGATCCTCTAAGCCTATCATAACTATTTTCATCTTATTATTTTCACTCTTTGTTCTTTTCC
CTAATCCTTCTTTAGCCAATTCAAGAATACTTGCTCTAGTTAAAGAAAAACCTCTTGTCCTAAAATACCATAAAGGGGCTCTATTAAAAGGAAAC
GTTACGATTAATCTTATATGGTACGGAAAATTCACTTCCGTACAACGTTCGATTATCGTCGATTTCATCCGATCTCTTAGCCCTAAGACCAAGAA
AATTAAGTCACCACCTTCCGTTGCTTCGTGGTGGAGCACCACCGAAGCGTACAAAGGTGGTGCGTCGGTTATTTCCCTAGGAAAACAAATTTTCG
ATGAAAAATATTCTCTAAGAAAATATTTGAAAGACCATCAACTCGAATCTTTGGCTTCTAAGGCTACTCGGGTCAACTCCATTGCTGTCATATTG
ACGGCGACAGATGTGGGGGTCGACGACTTTTGCATGAACCGATGTGGCATGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367581] SGN-U564308 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179143 [Download] [View] Facility Assigned ID: TPTBB50TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5