Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E367674

Search information 
Request: 367674Match: SGN-E367674
Request From: web userMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C109452Clone name: cLPT-14-N5
cartOrder Clone
Library Name: cLPTOrganism: Solanum pennellii (formerly Lycopersicon pennellii)

Tissue: leaf trichomes
Development Stage: 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367674Length: 525 bp (793 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367674 [] (trimmed) GTGGTCGAAAATGACGGCGTTGAGGCGAATCGACGTTTCGATGAACCGGTTAACTGGTACGATTCCGAGGGAGTTGTGTGAGCTGCCTCTTGAAT
CACTCAATCTTTATGAAAACCAGATGTTTGGTGAATTGCCACAAGACATTGCAAATTCACCAAACTTGTATGAGTTGCGCCTTTTCCACAACCGT
TTTAATGGGAGTTTACCTCAACATCTTGGAAAAAATTCACCTTTGTTGTGGATTGATGTGTCGGAAAACAATTTTTCTGGTGAAATTCCGGAAAA
TTTGTGTGGTAAAGGGTTGTTGGAGGAGCTTTTGATGATAAATAACTTACTTTCTGGTGAAATTCCGGCCAGTTTGAGTGAATGCCGGAGCTTAC
TGCGAGTGAGATTGGCTCACAATCAGTTATCCGGTGATGTTCCGGAGGGGTTCTGGGGTCTGCCTCACCTTTCCCTGCTTGAGCTCATGGACAAT
TCACTCTCCGGAGATATCGCGAAAACTATAGCTAGTGCTTCAAATTTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367674] SGN-U599988 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T179989 [Download] [View] Facility Assigned ID: TPTCC75TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0080 Quality Trim Threshold: 14.5