EST details — SGN-E367828

Search information 
Request: 367828Match: SGN-E367828
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C175839Clone name: TUS-22-G5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: SGN-C175839 is on microarray TOM1 spot ID 1-1-4.3.11.5 [Order] [Tomato Microarray Database]
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C16909 [cLED-17-P13] Trace: SGN-T53018 EST: SGN-E238576 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E367828Length: 298 bp (937 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E367828 [] (trimmed) GAACTGAAAAGAGAGGACTTCAAAGGTTCTAAGTGGCTGGTACTGATATATGCCATACTGAATGTAGAAGTTATTAAGGTGGCCATCAAAATAGC
AGAGGAAGAAGGTCTTTTTGTTTCTCTAGATCTTGCCAGCTTTGAGATGGTGAGGAAGTTTAAATCACCTCTAATTGAATTATTGGAGCTCCGGA
TACATAGACCTTTGCTTCACAAACGAAGATGAAGCAACTGAACTGCTAAGGGGTGAATACAACAGCAGATCCTGATGCAACACTTGAATATTATG
GACTAATATTGCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E367828] SGN-U575038 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T180442 [Download][View] Facility Assigned ID: FA0AAD10AD03RM1
Submitter: Koni Sequencing Facility: INRA
Funding Organization: Funding for 5' and 3' resequencing of TOM1 microarray clones was provided by INRA. Sequencing was performed by Genoscope, Evry cedex, France. \ \ \
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.950 Expected Error Rate: 0.0217 Quality Trim Threshold: 14.5